CX286945

Overview
NameCX286945
Unique NameCX286945
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length230
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01002H02Rv Veg1 Citrus clementina cDNA clone C01002H02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286945 ID=CX286945|Name=CX286945|organism=Citrus clementina|type=EST|length=230bp
AATTGACAAGTCTTTCATTTAAGCTTTTATCATTAGAAAAATAAAATTAA
AAAAATATAGCTTCCCTCAGACCTAAATGATCCAATATTTTCTATATATA
CGGATGCACATTGGCATTGGCAATACTGACAGGCGGCAGACCAAACTGGT
TGAATAAACAAATTAAGCCAACAAGAAAAATACAACTCAATTAGCCTTCA
ACACTTTTGTATTTGCAGGGGGGGCCCGGT
back to top