CX286953

Overview
NameCX286953
Unique NameCX286953
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length589
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8162 contig Ccv1_Contig8162:4..592. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01002H11Rv Veg1 Citrus clementina cDNA clone C01002H11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286953 ID=CX286953|Name=CX286953|organism=Citrus clementina|type=EST|length=589bp
GCTTATCTTCTTCATCCTCCATGAAACTCCCTTCCAAATCAATCTTGAGC
CCCGGCCGTGGTAGAGATTCCTCACAAATCTCCCTCTCAACTTCTCTGAG
CAGAAGGCTGAGGAACAGTGGGAGCTTAAAAGGTGGCCAGGCTTCACCCA
TGTTCCCAGCAACCGCTACTAATGGGAAGAAACGAGGCTGTTCTTTTGAG
AACCCTGAGCCGTCTTCGCCTAAAGTTACTTGTATTGGTCAAGTGAGGGT
TAAAACCAAGAAGCAAGGGAAGAAGATGAGGGCAAGATCCCGAAGGGAAG
TCAGCTTCAGGAGAACAGAACAAGGGGCTACTAACATCAGCATCAACAGC
GCAAGCACGAACAGTAACTGTAACAGCCACAACAATCTTGATGTGAATCA
TTATCAAGATTTTGTGCAAGGTCACCCACAAGAATGCTTGCCGCACAGAA
ACCAAAGATGGGTTCATTTGCCTGTGACAATATGTGAGGCTTTGAGGACA
TTTGGAGCTGAGTTTAATTGCTTTTTGCCTTGTAGATCTTCTTGCATGGC
GAGCAATAACAAGGAAGAGAAAGTGAACCATCACCACCA
back to top