CX287041

Overview
NameCX287041
Unique NameCX287041
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length571
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01003H09SK Veg1 Citrus clementina cDNA clone C01003H09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287041 ID=CX287041; Name=CX287041; organism=Citrus clementina; type=EST; length=571bp
CCTTCCGATCACTCTTCATTTCCAAATGAAAACCTTAATTTTTGTAATCT
CAATTGGCAATTACTCAAATCCATTGATTATTTCATCTCCGAATTTTCTC
ACTCATTTTCGATTATTTTCTCAAAAAAATAAAACACTCCTTCCCTTTTC
CCGCTCGAAATGTTTTTCCGATCCCAAAACTCTAGATTTATCTCCCATCA
AAGCTGTTGCATCGCCCGAGTCCATGAGTTAGGGTGGGTTGGAGGATTTG
AGACTCAGTGACACGGGTGAGTCAACTCCGTTGCGTGATTTTTTAATTTC
CATTGGAATAGATGATAGAAAGTATGTCTTTATGTTTATTTTAGGGCTTC
TATGTGCCTTTTCCATTTCTAGGGTCAGGGTGTCGTCTATAATTGTGTTT
CCAGCTACAGTTTTGGCTTTTGCAATTGGGTTTTTCATTTGGGTTCGTTC
ATGGAAGCTGCTTCAGTGAAGTATGTGCAAGTAAGAGAAGATTGAAAGAG
GGAATTTTTAGGCCTAATAGTGAGAAATTGAGGAATTTATTGGATTACTT
TGAACGTTTTGAAGGTAAAGT
back to top