CX287062

Overview
NameCX287062
Unique NameCX287062
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length548
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC01004C05SK Veg1 Citrus clementina cDNA clone C01004C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287062 ID=CX287062|Name=CX287062|organism=Citrus clementina|type=EST|length=548bp
GTGTCCCGTGCTTGGCACGGTGTCGCTTCCAGCGATTCGATTTGGTCAGC
CAAGTGCGAGGAACTGTGGCTCGGGAAAGCACACATACCTCATTTGGCTC
TAGTCCAGGGATTACCAAAGCTGGCCGCATATTCGTTGTCTATCATGGAT
GGAAAACGTACTCGTATCACGAAAGAAGACCTTTGTGATCATGCTTGGGA
GTTTCATTTTAATAAGGTGGTACCAGAGTATTGGCGTAATCTTGACCCGT
ACTGGAAGGGTACTAGCCCTCTCATGCACCGGTACTTTCATACAGATGGG
AGTCAAACTGCAGATCCTGGTGACAAGGAAACAGGACTGGAGCTGGGAAA
TGTCCAACGTCCTCTGCTGCTACTCCAGTGTTCCTGATGCCCACAGAGGC
GGTGACACAGGGCCTCTTCTTCCAATTGGTTAGTACAAGTCATGTCGAGT
TTGCTAGATGCTAGATATTACTTCTTAATCCTTCATAATATAGTGTTCAT
AAGTTTATAAATGCTTTGTTGTAAATGACCGTAAGTGTTAACTAGATG
back to top