CX287071

Overview
NameCX287071
Unique NameCX287071
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length500
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11622 contig Ccv1_Contig11622:429..928. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01004D02SK Veg1 Citrus clementina cDNA clone C01004D02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287071 ID=CX287071|Name=CX287071|organism=Citrus clementina|type=EST|length=500bp
GAAGTTGGATGATGGGTTGCCTGTTTTGGCTCCGTTTCAGCTGGCTGGTC
CCATGGAGCTCTGGATTCAGGATGCTAAGGACATGCGTATCTCCTTGCCG
CATGACGTGGATGCGGGAGTCTTGAAGAAGGTCGTTTTAGCAGATGGTGC
AGTTGTCACTGTCAACGGTGCCAGATCAGTTAGCCTGCGCCACCCCATTG
ATCTTCCTCTTCCCTTGAATCAATCCAATAATGGGTTTGCTTCTGGTCTG
CTAACACTGGCTGAACAACTTCGCCATGCTTCCCGTGCTCAAGGTGCCCC
ACTCCTCTCCCTTCGCATTGTTGGGCCTACCTCTCTTGCAGCCCCACCTG
CATCCTCACCATCACCCAGTAACAAGCTGAAGCTTAAGCGTCTAGCACCT
GGCCTCGTGGAATTATCCTCACGAGCAAAAACTGAAACCACGGATGCCCT
TTCAACCATAGATCTTCAAGAAGGAGCCACTACCCTTCTGACTCCAAAAC
back to top