CX287074

Overview
NameCX287074
Unique NameCX287074
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length524
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC01004D05SK Veg1 Citrus clementina cDNA clone C01004D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287074 ID=CX287074|Name=CX287074|organism=Citrus clementina|type=EST|length=524bp
CTCGTGCCGAATTCGGCACGAGGGTTGAGTCCAGGTGATGATGTGGTAGC
TGCTAACTCAGGCCCATTCCTTCACGAAGATGTTATGTCTTTGAAAGGTT
TGGAAGTCATTGCTGAGCAGCCAGACCCTGTTCAGAGTGCACCAGAACCT
GCAACCGTTATTCGTCCTCCAGTCACTCAAGACCCTAAACCTGCTGAGAA
AAAGTCTGTCAAGCCTAAGTGGCTGAAAATGTGATATGACCACATCAAGT
GAGCTCTTTGTGCCTTGTTTGACTATGGCCTGTTTCATCTGGGTTATCTG
TCTTCATCTCAACCTGCCAAGAAAAGAAATATTTAGATAGAAGAAAGAAA
TTAGGAGACTGATTTTGGCTTTTTGTTGGTGCAGGTGCGCTTCAACATCT
GCTCTTGAAGTCTTATTAAAAGTTCAGTTCAAAGAATAGATCAAGGCAGA
TGGCATACAAATTGGTTTAATTTGTAAAGGGTCTGAAGCAGGTTTGTTCT
TTCAGCAAAGCTGCTACCCTAATT
back to top