CX287084

Overview
NameCX287084
Unique NameCX287084
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length358
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX287084_ssr4 microsatellite CX287084_ssr4:4..15.
Properties
Property NameValue
Genbank descriptionC01004E05SK Veg1 Citrus clementina cDNA clone C01004E05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287084 ID=CX287084|Name=CX287084|organism=Citrus clementina|type=EST|length=358bp
GAAGATGATGATGATGAAGGATGTTGGGAAGGCAACCTCAATGACACCAT
AAAAAAATTGTTCAATGAAATGAATTCTAAAGAAAAGATTGAGCCAATCC
TTCAGGTACAGTGAAGAAGCTATCTCGAACCAGGCCAATCTCTTGTACAT
AATTCAACTTGCTCGTTCTCCTGTACTTGAAGAATTTGGTTCCAAACGCA
TTTACAACTTTTTTGTCATGCTACAGACTTGCAAGACACTTTGGATTTGT
TTGATGCATTCTCTGTTTAAGGAAGGACTTGAATTGATGTTTCATGTTTC
ATGCAATTTTCAATTAGGTACTGTTTAAACTTCTGCATTATAAAAAAAAA
AAAAAAAA
back to top