CX287085

Overview
NameCX287085
Unique NameCX287085
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length299
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15323 contig Ccv1_Contig15323:642..940. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01004E06SK Veg1 Citrus clementina cDNA clone C01004E06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287085 ID=CX287085|Name=CX287085|organism=Citrus clementina|type=EST|length=299bp
TTGCAGTGTTATTTGGATTTCTCTTCGCCCTAGGAATTAAGATGTTTAAC
TTCCAGAGGCGGTAGTAATTCTGATAGGTACTGCTGCTGAACATGCGATT
CAGAAGAGAAATCGCGTCGCGGATGTTTTGGCTATGCTATAATCTTTTCA
TGCAATGTCCCGTCAGTGTATTGTTTATTTTGATTTAGCATTTTCATTGC
TGGCATTGCAAGATATATTTTGTATACAAGATATGTTTTCTATCTTTTTA
GATTAATAAATTTTCCCTCGCCAGTCAAAAAAAAAAAAAAAAAAAAAAA
back to top