CX287091

Overview
NameCX287091
Unique NameCX287091
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length321
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10042 contig Ccv1_Contig10042:65..385. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC01004F02SK Veg1 Citrus clementina cDNA clone C01004F02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287091 ID=CX287091|Name=CX287091|organism=Citrus clementina|type=EST|length=321bp
ATCTTTCATAAGAATCCGAAAATGGCTGGATCCGGTGGAAGTGTTCCTGC
TCAGGCTACTGATTTCTCCTATGAAGGTGACAATAAGAATGTTATCGCCG
AGAGCCTTGAAGTAGTTCCTGAAGTTGCACCAGAGAAAGTGAACGAGGGA
GACGACAACGGCGGCTGCAAGTGCAACCCATGCAACTGCAACCCGTGTAA
CTGCAGCAAATGAGAGACAGATGCGCCATGCGGCCTATGGAATTAATTAA
CCAGCTGCCTGTTTAAAAGCATATATATGGATCTTTTTTAAATAAGAACT
AATATAGAATCTAAGACCTAT
back to top