CX287093

Overview
NameCX287093
Unique NameCX287093
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length475
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11008 contig Ccv1_Contig11008:141..615. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01004F04SK Veg1 Citrus clementina cDNA clone C01004F04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287093 ID=CX287093|Name=CX287093|organism=Citrus clementina|type=EST|length=475bp
TACGCGATTACTCCCTAATCTCCGTCAAATCACTTGCTCTTCTCGATTTT
CCACTTCCACCGTAAATCCCCAATCAGGCCCTAATCATCAAGTCAACAAT
GAAGCCCCTAATTTCACGGATTCCAAGACGACGTCGTCTTCGTCTGCTGC
AGAGGAAGCTCGTGATGCTCGCAGCCATAAGAGGGAGAGACCGAGAGTTG
TGGAGTACCGAGACGAGCAGGCGCGAGTGCTCGAGGCGTCTCTGCGCCAC
GTGGCGAAGCACGGATGGGGCGAGGCGGCTATGATTGCAGGCGCAAGGGA
CGTTGGCTTGTCTCCTTCCATCATTGGATCTTTCCCCAGAAAGGACGCCG
CTCTCGTTGAGTTTTTTATGGATGATTGCTTACAAAGGCTAATTGATAGA
ATTGACTCGGGGGAGGATTTAAAGGACTTGATTCCGAGTCAGCGCATCTC
GAAGCTGGTTCGAATTCGTCTGGAA
back to top