CX287095

Overview
NameCX287095
Unique NameCX287095
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length538
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX287095_ssr9 microsatellite CX287095_ssr9:9..18. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig14614 contig Ccv1_Contig14614:45..582. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01004F06SK Veg1 Citrus clementina cDNA clone C01004F06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287095 ID=CX287095|Name=CX287095|organism=Citrus clementina|type=EST|length=538bp
ACAACAATTCTCTCTCTCCCCAAAATTATTACGCTTTCTCGCTCTAGGGT
TTCGCACTTTTGGGGATTTTTCTTTTGATTCCTCAATAAAGGGCAAAAAT
TTAATCTTTTCTCTCAACCTTGGTCAGTTCAAATGGAGAATCGAATTGAT
TTTGTGAACTGGCTTGATCCCGACATGTCTATTCAGATCCTCACTTGTTT
GGATGATCTATCTGATCTTCTCCGTGTTACCTGTGTCTCACGTTGTTGGC
GACAGTATGTCATTGCAAACGGTCTCTGTCGGCAGCTGTGCCTAAGAATG
TTTCCTCAGTTATCGAAAGTTGTTCATGTAGTGGAACAAAGATATGGTAC
AAAAGACCCTGCAGAGGTGGGATCTAGTAATTTTATGGAGTGGCAAAATT
TGGAGAGGGAGCACAGAGCTTATGCCTTTTTAGCACGAGGTTGTACAACA
TTTCCTATTAGAGATTTGATTTCAGAGCCAATCTGTGCTTCCAGCACTGA
TAATTATCCAGAGGAGAGCATCGACAATACTCTGGAAC
back to top