CX287096

Overview
NameCX287096
Unique NameCX287096
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length699
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01004F07SK Veg1 Citrus clementina cDNA clone C01004F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287096 ID=CX287096|Name=CX287096|organism=Citrus clementina|type=EST|length=699bp
GCACGAGGTTTTTTTTTTAACTCAAGGCAAGATGAACACTATCCAATAAA
AGACCGTCAAATAACACATCATATGTTTGTAAATCATAATACTTTCTGGG
AGTTGCACCATAACAAGTGTGATTTTGATTGTCTACCGACTGATACAAGA
AAACAAAAATCTTGGCCGTGCCTTATCAACCAAATCATGGTAATTGGTGT
ATAAAAGATCATTACATCCTCATGAAGGTGGGTGGCTGCAAGCTATTACT
CTGCATGAGACAAATGATAGACAAATTAGTCAGAATATTGGAGAAATACA
CAGTAAATCACTTGACCTGTTGGCAAAATTTATACAGAATTTGTTCCATC
AGCTCCTGCTTTTATCATACAGTTTCTTTACTAAATCAAACTCCACAGAT
GGCTCGAGAGCCAAAATATTTAGAGAGATCAATGAGAAAAACTGGATGAA
AAAGATCAAAAACATTTTCAGCTTCCACTTCTATCAGTCAAGTTGAAACC
AAAAAGTAGACAAATATCAAGAATTGTTTTTGTACATTCACAGAACTCAA
AACTGGCAAACTCATTGTTACCTAATGAAAGATAGAATCTGCTGAAAGGT
TGATTCAAGCCACCATGCTAGCTAAAGGAAAACATCAACTGAATCGATGT
GTAGACAAGTATAAATCTTCTGAATTATTTAATGCATGCATGAAACTTT
back to top