CX287106

Overview
NameCX287106
Unique NameCX287106
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length585
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX287106_ssr218 microsatellite CX287106_ssr218:218..233.
Properties
Property NameValue
Genbank descriptionC01004G06SK Veg1 Citrus clementina cDNA clone C01004G06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287106 ID=CX287106|Name=CX287106|organism=Citrus clementina|type=EST|length=585bp
GGCTTGAATGATAATTTCTCATTCGTAATTAATTTTGGACACTAGGAATA
AAGTGAGTTTGCCCGTGGTAAATTTTTATGTAATCAATTACAGAAGCCAT
TTTGATTCTTGTGGCCATTAAGCCTATAATCAAAGGCCTGATACCTTTTT
CTATTTGTGCCTATAAAGTGATTTAATGTTGATAATTCTTGATCCTTTTA
ATACATTTTATTACTTAATATATATATATATATAGGTACACTGTAGCCGA
TTTCTTATCCAGACCGGTTACCATGATTTCAAGAAGGAGCCTCCCTCCTT
CTTACGCTTGCTTGGTCTGCAGTAGCATGTCAGAGGGTCTTGGAGCGAGT
CTAATGTCTATAAGCTCTCAAACCAATTTTGGGCTCGAGAACAGTACTTC
GTGTCGCTACCATACAGGCAAGTGCCAACTCAAAACCCATCTTCGTGTGA
AGACATCGACTCCATGTGGACAGGATGCTTCACAGCAACGAATGGCCTCA
GCAGATCCATGAAGCCCGGACGCGAGACTCCACAATGACAATGAAGGGGA
GGAGGACATGCAGGAGAGGTACAGAGAATACCTCA
back to top