CX287111

Overview
NameCX287111
Unique NameCX287111
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length603
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01004G11SK Veg1 Citrus clementina cDNA clone C01004G11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287111 ID=CX287111|Name=CX287111|organism=Citrus clementina|type=EST|length=603bp
CGGCACGAGGGAGAACTAGTCTCGAGTTATTTTTTTTTTTTTTTTTTTTT
TTTTTTATAAAAGGTAGGTCATCATTTCCAGCATTTCCAGCACTTACAGC
ATTAGTACACGGAAACATGGATTTATCAATGAGAATAACTACCAAATACT
ACCAAACGCATAGCACTACACAGAGACAGTATAGAATGACCATGTCCAAG
TATTAAGTTAAAGATGGTCCAGCGAAAGGCACACAAATTAGGATGGTAAA
TATTTGGTTCTACACAAATCGGTATGTCGATTCATCATCCATATCGACAG
CATCACCTGCAGATAATGCTGCCGCTTCACTTGTTTCACCCAGTTCAGCC
TGCAAGAATGATTGAATATATCAGAAAACACAATTGAAGATACCAAAGGC
AAAATGCACCAAGTGCAAATACTTCAGGAGCTGTATTTTCAAAAATTCAA
AAGCCAACTGATTTTACAGAAAATTAGATGGTGGATCATCATCATGATCC
ATCATTCATGATCATTGACTTGAATTACAAGTCCAACTTCACAACCTACA
AGCTCCAATATAAGGATGTTGATCCCACTTACTAGATCATTAGTTCATAT
AAT
back to top