CX287123

Overview
NameCX287123
Unique NameCX287123
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length402
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX287123_ssr373 microsatellite CX287123_ssr373:373..384.
Properties
Property NameValue
Genbank descriptionC01004H11SK Veg1 Citrus clementina cDNA clone C01004H11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287123 ID=CX287123|Name=CX287123|organism=Citrus clementina|type=EST|length=402bp
CCGGCACGAGGCACTCATCGTGTTGATTATCATCGACGTCTTCAACGATC
TCGCTAAGCAAAAGCCCAGACCCTTCCCATCTTCCCCTCGCATTTCATAA
AAATGGCAGCAATGAAGAAGATTAATAGAGTTGCTTTGATTTTTGTGATG
GCGGTTTTTGCTGTGGCTGTTGTTTCTGCTCAAGAACCGGCACCTGCGCC
GGCACCATCCATGGACAAGGGAGCTGCTTCTTATTCTACGGGGCTTTCTG
GGGCCCTCATTTGCTCTTCTTTCTTCTTGTCTGCTCTTGCTTTCCTCAAC
CATTGAGTTTCTATTCATTATATTGTTTTTCGGGCTCCTTTTGTACCCTC
TGTTTTTGAGACACTCGTTTTTTTCTTCTTCTTCTTTTTCTTTTTGTTGA
TG
back to top