CX287149

Overview
NameCX287149
Unique NameCX287149
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length669
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01005C03SK Veg1 Citrus clementina cDNA clone C01005C03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287149 ID=CX287149; Name=CX287149; organism=Citrus clementina; type=EST; length=669bp
GTCATGGACACAGCAACAAAGTCGGTCCTTCAAGTAGCTGGATATCCTCA
TTGCAGCGCATTTCTTCTGCCAAGTGATGAATTGGTAATTATCTAGTTCA
TACAGTTTTTGGGTTTTCTGCTCCCATTTGTGAAGGGGAAAATTCATGTG
TTAAAAGTTGGATTCTTTTTTATTGCAGCTGCTTTTTTCCTCACCCATCA
GTGTGTTGACCAAATTGTTCTCATTAATGTCTTTAGCTATGGAACTGGTC
ACGAAGATTCTAGAGTTGCATTTGTGGAGGCAACAAATTTGTGATTATTT
GAGGTTATGTTTCTACTGTGATTCTGGTGGAAAAGTTGTTAGTGTCGCAC
TCATGAATATGTGCTGCTGATTTGAAGAATTGTGTTAGTGTGATCCCAGC
TCGCATTTTTTTTTTTTCCTCTTACGGTGACTACAGATACATTGGCTGTT
ATATGAAATACAGATACTCAAAGCATGGTTCCTGAGCTGTACATAGATGT
CATGAATGACTTTTCAACCTTGTATTAATGGTTCTCTGTAACATTAGTCA
TATGTGAAGAATTCTCACCCCTTCCCCTCAGCTCCTCCCCCTTTTTTAAC
TATTCAGTTTGCTTTTGCCATATGGTTGTCAATAGAATTTTTGTTTTGCT
TCAAAAAAAAAAAAAAAAA
back to top