CX287185

Overview
NameCX287185
Unique NameCX287185
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length616
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX287185_ssr476 microsatellite CX287185_ssr476:476..487.
CX287185_ssr371 microsatellite CX287185_ssr371:371..385.
Ccv1_Contig9653 contig Ccv1_Contig9653:269..884. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC01005F06SK Veg1 Citrus clementina cDNA clone C01005F06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287185 ID=CX287185; Name=CX287185; organism=Citrus clementina; type=EST; length=616bp
ATAAATAGCAATTAGCTTGAGCAACAACAATGGCTTTATCCAAGACTTTC
CTCCTTCTTGGCCTTGCATTGGCTCTTGTTCTTCTCATTTCCTCTGAGGT
CTCATCAGCTCGCGAGCTTGCTGAAGCAACCCACACCCAGAGTGCGGAGG
ACAGGACAAGATTGGACGAAACCAAGTACGAAACTGATCATTATTGGTAC
GGACACGGATATGGCCATGGACATAAATATGGTCATGGCAAGGGATACGG
ACACGGTGGATATGGACATTACGGCAAGCCTGGCCATGGAGGTCACCCCG
GACACGGTGCTGATGGAGTTGAAACCGAAGATGGAGGGAACTAAATAAAC
CCTTGCTAACCTAGCTAAGCCTTCTTCTTCTTCTTCCTTGATGGCTAAGC
TAGGTCTTTTATGAATGTGTTGCTTGCTGAAATAAATAACTAAGCTTTAG
TTTATGAATGTTTTCTTGTCAGCAAGTGTGTGTGTGTAAGGCTCGATATT
GAGATGTGGCCATGAATGTTCTTTTATAAGGCACCATGGTTACGTTGATA
TTGATCGGGTAATTTGTACTACTATAAAATATATAAGTGTTTTACTTCTT
GTAAAAAAAAAAGGGG
back to top