CX287314

Overview
NameCX287314
Unique NameCX287314
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length383
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX287314_ssr260 microsatellite CX287314_ssr260:260..277.
CX287314_ssr155 microsatellite CX287314_ssr155:155..166.
Ccv1_Contig15042 contig Ccv1_Contig15042:664..1046. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionC01008B09SK Veg1 Citrus clementina cDNA clone C01008B09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287314 ID=CX287314|Name=CX287314|organism=Citrus clementina|type=EST|length=383bp
CTCGTGCCGAATTCGGCACGAGGAACACAAGGAGGGCTTGGTGGACAAGA
TCAAGCAGAAGATCCCCGGTGTTGGCGGCGGCGAGGGCGCCGCCCACGGT
GAAGAGAAGAAGAAAAAGAAGAAGGAGAAGAATAAGCACGAGGACGGACA
CGAGAGCAGCAGCAGCAGTGACAGCGATTAAATTAATGAACTTTTATGTG
ACGCATCAACATCAGCATCATCATCCATCATCTTAGATTTATTCTATAAT
AAAAATTGGGTGTGTGTGTGTGTGTGTGGTCACAGTAAGAGCTTGCTGCT
TTATTTTTGGGGTGTCTCCTCAAGGTGGTGTTGTGTTTAAATTATTATTG
CTTTTGAGAGACTCTGTTTTTTTTTTATTTATT
back to top