CX287327

Overview
NameCX287327
Unique NameCX287327
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length413
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig930 contig Ccv1_Contig930:569..981. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01008C12SK Veg1 Citrus clementina cDNA clone C01008C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287327 ID=CX287327|Name=CX287327|organism=Citrus clementina|type=EST|length=413bp
TTTTTTTTTATACAAATACTAGCTAGAATTACGATTTATGAAAGGCTCAT
ACAAACAACAATAGAAGCACTTAATCAGGTGCTACCAACTTAAATAAAGT
TTAAGCAATTTCTACACCATCAATTAAGGACGGTAACCAACACTTGACAA
TAAAAAAGACTATCACTATAGTTGAGTTCCAATCTAATGCGCGACTGCAC
ACGTGGCGAGTGTTCATTAGCAGGATTGTGGTCCCCACGATGTGGCTCCA
CCAATTATAAATCGCCATGCACGTAGTCGCACGCTATAAGATACGTGCAA
CAAAGTGTACCTAATCGAAATCCATCACCAGTTACTCGATTCAGAAACCA
TATTATTTCAAACTCTTTCATGAATCATAGTTTGAGGAATACAAACTCTT
CAATTGCAGGCAC
back to top