CX287330

Overview
NameCX287330
Unique NameCX287330
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length404
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig859 contig Ccv1_Contig859:11..414. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01008D03SK Veg1 Citrus clementina cDNA clone C01008D03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287330 ID=CX287330|Name=CX287330|organism=Citrus clementina|type=EST|length=404bp
GCCGGTTCCATTCTACTCAGCAGAGAAAGAGATCAACAACAGAGCAAACA
AATGGCCTCAGTTTCAATGGCTATGCCACTGAGCTCAGCAACCCAGAACA
GGCTTATTCAGCCTAGCTCTGAATCCTTCCTGAAGCCGTTGCCTGTAAGG
CCATCAAAGGCAGCTAGATTCTTGGGAAAGCCAAAGTCAAGAGCCAGGCT
TCAAGTTCAGGCTTCTTTGAAGGAAAAGGCAGTGACAGGACTGACAGCAG
CTGCTTTGACAGCTTCAATGGTGATTCCTGAGGTGGCCGAGGCAGCTGGC
TCTGGTCTTTCCCCTTCTCTCAAGAACTTCTTGCTCAGCATAGTTGCTGG
TGGAGTCGTCCTAGCCGCTATCGTTGGAGCTGTCATTGGTGTCGCCAACT
TTGA
back to top