CX287331

Overview
NameCX287331
Unique NameCX287331
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length424
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig252 contig Ccv1_Contig252:1..417. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01008D04SK Veg1 Citrus clementina cDNA clone C01008D04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287331 ID=CX287331|Name=CX287331|organism=Citrus clementina|type=EST|length=424bp
TCGGCACGAGGATAACACACAGCTAAAAAGGAAAAAAAAAAAAGTTGAGT
AGACATCGTCTCAATGGCGACGGCGGAGACACAAACGATGGTGGTAGGGA
TCGACGATAGCGAGCAGAGCACGTACGCGCTTCAATGGACGCTCGATCAT
TTCTTCGCAAATTCGACTGTAAATCCTCCTTTCAAACTCGTCATCGTTCA
CGCCAGACCTTCCCCTTCAGCTGTTATTGGCCTCGCTGGACCTGGAGCTG
TCGAGGTTTTGCCTCATGTGGACTCAGATTTCAAGAAGATTGCTGCAAGG
GTTGTGGAGGAGGCTAAAGAAATCTGTAGCAGTAAATCGGGGCATGACTT
TGTTGTTGAGGTGGTGGAAGGAGATGCTCGAAATATCCTCTGTGAGGCTG
TAGAGAAGCATCATGCCTCCATAT
back to top