CX287334

Overview
NameCX287334
Unique NameCX287334
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length415
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC01008D08SK Veg1 Citrus clementina cDNA clone C01008D08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287334 ID=CX287334|Name=CX287334|organism=Citrus clementina|type=EST|length=415bp
GCCAACCGAACCTTTTGGCAAACAAGAGGAAGAAATTTATGTTATCAACA
GTTATCTCAAAAGAAAATGAAAATTCTGTGACCTTTCAATGGGCTCCATT
TCCTGTTGAGATGACTGGTGCATCTGCAGTTGTTCCATCTCCATCTGGTT
CAAAGCTTCTTGTTGTTCGGAATCCTGAAAATGAATCCCCCATTCAATTT
GAACTCTGGAGTCAATCTCAGTTGGAAAAGGAATTCCATGTCCCTCAAAC
TGTTCATGGCTCAGTATATGCCGATGGATGGTTTGAAGGAATCTCTTGGA
ACTCTGATGAAACTCTCATTGCTTATGTTGCTGAGGAACCGTCTCCCTCA
AAACCCACTTTCAGTCTGGGCAGCACAAAAGGTGGTTCCTCGGATAAGGA
TTGTAATAGCTGGAA
back to top