CX287336

Overview
NameCX287336
Unique NameCX287336
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length389
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2589 contig Ccv1_Contig2589:596..971. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01008D10SK Veg1 Citrus clementina cDNA clone C01008D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287336 ID=CX287336|Name=CX287336|organism=Citrus clementina|type=EST|length=389bp
GAAGAACTAGTCTCGAGNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TAGCTATTCATCTCAATGCCATCAAAACCAAAATTAAATACATATATATA
AAAAATCCCACAACCAGTCCCAAACAATGCAGCAATCAAAAAAAGACTGC
TATACACTCAGCAATCTTGTAACCAAAATTCCTAAATCCCTCAAGATGCA
AAACTCATCTTTCAAGGAAAATTTGAGCTTGCAAACCCTGCACCAAAACC
ACCGCCGCCACGACCAAACCCTGGCCTTCCACCAGGGCCCCTGAAAGATG
GCTGATAGTCAGCAGGAGCTCCACCCTTGTCACCAAAATCACCACCTGCT
CCTCGTGGAGCTCCGCGGTATCCATCTCGGTCACCAAAT
back to top