CX287337

Overview
NameCX287337
Unique NameCX287337
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length401
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC01008D11SK Veg1 Citrus clementina cDNA clone C01008D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287337 ID=CX287337|Name=CX287337|organism=Citrus clementina|type=EST|length=401bp
TTTTTTTTTACCGAAACAAGAACATGTATTTCGTAATTAATACACCGCCC
TTACAACAAAACCAACAGGAAAAAAGACAGGGAAAATAAAAAGGCGGAAA
CGTAAATGCCATTTTTATTCGAGTTCATTTCTTTCTTACAGGTAGGAATG
GGGGAAGAGTAACATAGGAATTTGTTACCGGAACAAGGGCATGATGAGCT
TCTTCTAGTTCTAGGGCTTGCCAGACTTTTTTCTTAGCCGTTCTCTGACA
AAATCATTGCGAGCCTTAATTCTTGCTTGTTGAGGAGCAGCATTGACATA
AGACAAATGCAGGCCAACAGCAAAAAGGGCAGCCCCGGCAATGAAGTATC
CCACAGTGATTGACAACTTCTTGGGCGTCGAAAGAAAGCACGATGATACC
A
back to top