CX288488

Overview
NameCX288488
Unique NameCX288488
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length309
Libraries
Library NameType
IF1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14378 contig Ccv1_Contig14378:330..638. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02001A03SK IF1 Citrus clementina cDNA clone C02001A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288488 ID=CX288488|Name=CX288488|organism=Citrus clementina|type=EST|length=309bp
TAAACAGAATAGACACAAACTGACGATGACATGAAAAGCAAAGACAATAA
GACACAACATGAAACGAGGGCGGGAACGAGACTCGCAGTACAAAGTGTAG
AGAGAGACTCATAATTCGGACACAAAAATGTCCTTATTATTATACATTTA
TTCTACTCCGTCAACTTAAATATGAAAATCAACAGCCCAGATTCCTGTTC
ACCGGACCTTAGAGCAGTCAGTGGAGATGCTGATCTTGTAAGGAATGCTG
ACTCCACAAGCTCGTGGAAGACCAACAGCATTATTAGGGTTGAGGTTAGG
GATTGATCC
back to top