CX288498

Overview
NameCX288498
Unique NameCX288498
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length505
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC02001B02SK IF1 Citrus clementina cDNA clone C02001B02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288498 ID=CX288498|Name=CX288498|organism=Citrus clementina|type=EST|length=505bp
TAAACAGCAACGCAGTGGTAAACACGTGCTTAATTGCTTCATTCGCGGCC
TTGACATTGAGATCGGTGAAGCAACAAAACGACATCGAAGGGTTGGAATC
GGAGAAGGAATCGCTCGTCAAAGCAAACAAAGACTTGAAAAAGAGAATGT
GGGATTGGAAACAACAACTCTACGCCGAAGCAACCACTGAGTCTGCTTTG
GTTCCGCTCGCTAGACTTAAAGCAATTTACGGCGATGTCCCTACGCCCAC
GCCTCCTGCTGCAGGAGAAGCTGCGAAGGAGGATGCCAAATCATCAGCCA
CCAAATTGGTAATCTGAAATTTTAATGTACCGAAACTTTTGGGCTTTGGT
TTTGATGGTGATAGGCAATATAACTTCAAAAGCATATTGTATTGATCGTA
ATTCCCTACATGTGTAGTAGAAAGAAAATGGATAGTTCTGTACAATGATC
CCCATTGAAAGATGAATAATGAATGACCTTTTTGACCAAAAAAAAAAAAA
AAAAA
back to top