CX288513

Overview
NameCX288513
Unique NameCX288513
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length572
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13656 contig Ccv1_Contig13656:60..631. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02001C05SK IF1 Citrus clementina cDNA clone C02001C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288513 ID=CX288513|Name=CX288513|organism=Citrus clementina|type=EST|length=572bp
ACAGCTCCTCAGTGTCGGCACCACCCCTCAACGGTATCTGCCCCCCTGCG
TGTGCATGGCGTGATTCAACTCAGTCCCTCTTGGTCTCTCCCTCGCCTCA
CACCACGATCAGCGCCTAGCACAACCCCTCAGTAGCAGGACAACCCCTCC
CCTCAAGCACGGTGACGCCGTCGTTAACCCTCACGCACGGTCATCTTGGG
CTGCAGCATTGGTATTAGAGCCGCCGAGAGGGAAAAGTAAAAAAAAGTGT
GCAGCAGCAATAATTTTTCTTTCATTACAGCAGCAGTTTCTACATGGCTT
CTGATAATTATGTTCAGCCTCCAATCCCACACTTTGATAGTCATTATGAT
CATTGGAGCATGTTGATGGAGAATTTTTTAAGGTCCAAAGAATATTGGTA
AGTGATCGAAGGTGGCGTGACGAGGTTCCTTTCACAGAAGCACAAAGACT
TAACAAGAGGCATTAAAGTTGAAAGACTTAAAGGTCAAGAATTATCTCTT
TCAAGCTATTGATCGTTCAATCATGGAAACCATTCTTTGCAAGGATACTT
CCAAGCAATTTTAGGACCCCAT
back to top