CX288526

Overview
NameCX288526
Unique NameCX288526
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length610
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7026 contig Ccv1_Contig7026:1332..1941. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02001D09SK IF1 Citrus clementina cDNA clone C02001D09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288526 ID=CX288526|Name=CX288526|organism=Citrus clementina|type=EST|length=610bp
TTTTTTTGATTGAGGAATTGGAGTAGGTATACTATGTGTTTCGATGATTT
CTGTTATTGACTTTCATGCTTTTGAGTAGGTGGCCTGTTCACAGTGCAGC
GAGACAATGGAGCGTGAAATTTTAGCCATCCATAAAGGTGAAAAGTGCCC
GCAAAGGATTGTCACTTGCGACTTTTGTGAGTTTCCACTGCCTGCAGTTG
ATCTGGCCGAGCATCAGGTGGCAATCGTCAATAATTTTGAAAATGGAAAG
ACAATAGCTGATGCCATATCTTCTTACTTGGGTGTGATGCTTTGTTGCTT
TGTTATTGTAGGAAGTCTGTGGGAATCGCACAGAACTTTGTCATCTGTGT
AACAGATATATTAGGTTGCGAGAAAGATATAACCATGAAAGTAGGTGCAC
AGGTGTCCCAGAAAACACTGTTGGATCTTCCAGGTATGTTTGCTTGTGTT
TTACCAGAGCTATAGTTACATAGATTTGTTTTAGTTACATTCCATCACTT
AGAACTGAACAGTGGCATTGGTAATTCAGAATAAATATAAGCTAAGATTT
TGAATCTTATGGAGTCAATTTGCGATGACCTGTGTTGATTCAAAATTCTG
GGAGTCTGGA
back to top