CX288791

Overview
NameCX288791
Unique NameCX288791
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length508
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC02004D11SK IF1 Citrus clementina cDNA clone C02004D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288791 ID=CX288791; Name=CX288791; organism=Citrus clementina; type=EST; length=508bp
AAGATGTCATGCAAAAGTACTTGAAAAAGGTTAAGCCTCTATACGTGCGA
GTTTCGAAACTGAAGTTCTCAGGTCAGTTAAACTCAGGCGCCGTTACAAA
GTCCGTCCAGTCAACGCCCCCAACAGCTGGTCAAAAGCCGAATCAGCCTA
AATCAACGGCTGAGAAGAGCCCTCTGCCGGATGCGGAGGTCGCTGGTGAA
ACTTTTGTTCAACTCAAGAGTCAAAAGCAAGCAAATATTCCGGAAAGGCT
TAAAGTTGTGTGCAAGCATTTAGGGAAGAGCCGATCGGCTTCGTCGGCTG
TGGCTGCCGCACCGGCCGGAGTTGTTACTTCAAGGAGAGATGATTCACTG
CTTCAGCAACAGGATGGGATTCAAAGCGCTATTTTGCATTGCAAGCGATC
CTTCAATGCCTCGAGAGATTCAGAGTCTTCATTGTTAGCAAGGTCGGTGA
GCGATCCGTCTCATCAGAAATTTGATTTATCCAGAAAATCATCGGATCCA
GGAAAAGA
back to top