CX288941

Overview
NameCX288941
Unique NameCX288941
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length524
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC02007B10SK IF1 Citrus clementina cDNA clone C02007B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288941 ID=CX288941|Name=CX288941|organism=Citrus clementina|type=EST|length=524bp
GTGAAACAGTCAGCTTGGTTGCTCATGTGGACCCAGAAGACATGCGTGGA
TGCATTTCATGGTGGTTGGTAATGGAGGATGGTTTTGCAGCGGAGAGAAA
ACTCAGTATAGACATTTCTGATGATGCTTCTGATTACAAGAAATTCTTGG
GCCATTTGTCTCTTGATGTCTTATACTCAACGCTGATGGATTTGGTTAGT
TTGTGCGGAGGTGGAAGCCACTGATCATACATCTCTCACACTTGTTTAAA
TTAACTCTTATTTTCTTTTGTAGTCGGTCATGTTTCATGTATCATTAGTT
TTCATACGTTATTTTCTTATAGGAGACGTGATTCTAGTAGTTGATTCTCT
GTATCTGTATAGACCGGTTATAGATATGGCTGTAAATGGGGAATTTTTTT
TTTCTTTTTTATTTGGGGGGGAGTATTTTAAAGTTAGGACAAAACAAGAG
TTGTAGCATTTAATTGTCACAATTCCTCCCATTTGTTGGGATGGTTAACC
GTCTTTATCATCTTATTTATTTCC
back to top