CX288948

Overview
NameCX288948
Unique NameCX288948
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length635
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC02007C05SK IF1 Citrus clementina cDNA clone C02007C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288948 ID=CX288948|Name=CX288948|organism=Citrus clementina|type=EST|length=635bp
TTGGAAGAACACTCTCAAAGAAATCTCTTGATATGGCTTTGAGACATATG
GATATAAGGCGAAGCATTAATTCAGGTAGTTTGCGGCCACTAATGACAAA
CATTCCAGCTTCTTCCATGTATAGTGTGAGATCAGGATCCATAAAAAGTA
GGACAGTTAGTGTTACAGACTCTCCTCTTGCCACAAGCAGCAATGCTAGC
TCTGAACCAAGTGTCAACAACAACTCCTTTATCTTAGACGGAAATGAACT
CGATGACATTCATGATTTTGGGAGTGAGAGAGGAAACTCCTCCCCTGTCA
GCCAGCATAGCTCCAGGTGACCCATTTCTGTATGTAGAAGCTCCACCAGC
ATGATGATTAAGGAACAACCCGTTTCTAAAGAAGCTGGTATTGCATGGCA
TTGTAATACTTTTATGTATCATTTATTAGGTAATGTTTCCAATATGTTAC
CTGTATTAGTGATTCTGATGATTCAGCTTTCTGAATCATCATTTGAACTT
TTTTTTTCCCCTTCTCTTTCCAGCGATGAGGACTATTTGTATATGAACTT
CGCTTTCTGGAAATCAAAAAGCTCCTGCTTTAATCTTTCTACCAGTTAAT
GAAACACAAACATTTCAAAGCAAAAAAAAAAAAAA
back to top