CX288954

Overview
NameCX288954
Unique NameCX288954
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length622
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14888 contig Ccv1_Contig14888:153..774. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02007C11SK IF1 Citrus clementina cDNA clone C02007C11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288954 ID=CX288954|Name=CX288954|organism=Citrus clementina|type=EST|length=622bp
AGTAACCAAAACAGGAACTGAAAATGAAAATAAAATTGGCAGCTCACTTT
CTGCTGCTGTTGGCCTTCAGTGCGTTCATGCTCTCGGAGGCCGAAACGCA
GCTGAAACCTCACGCTATTGAATCGTTTACCGTCAATTATATTCAGAAGT
TCGGGAACTGCACGTACCTGGTGGTTATAAAAACTAGCTGCGACTCAAAA
AACTTTACTCGTGATAGGATCAGCATCGCTTTTGGTGATGCTTATGGCAA
TCAGATTTATGCACCGAGACTGGACGATCCGTTCACCAAGACATTCCAAA
GTTGTTCGTCCGATGGGTTCCAGATTGACGGACCATGTGCAACCGATATC
TGTTATGTGTATTTGCACCGATCAGGACTTGATGGTTGGGAACCAGAGAG
TGTGAAGATTATCAGTCCAAATTCGAGCCCTGTCACATATGACTTCAACA
CCTCCGCTCCCAATGAGGATTGGTACGGAGTCAATTTGTGCCAGATACAT
CCTCCTCCTTCTCCATTTGAACCTTCGCCTCCTTTTCCATTTAAACCTCC
GCCTTCTCCTCCATCTTCTTCGCATCAGCATCGCGTTCCCGGATTGTTCG
GGCTCGTAATGATTCTGGGATC
back to top