CX290863

Overview
NameCX290863
Unique NameCX290863
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length442
Libraries
Library NameType
OF1cdna_library
Properties
Property NameValue
Genbank descriptionC03001A06Rv OF1 Citrus clementina cDNA clone C03001A06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX290863 ID=CX290863|Name=CX290863|organism=Citrus clementina|type=EST|length=442bp
AATCAAACATTTTAACATTGTATTTTTCAAATTTAATTTGAAGCACAACA
GTTACGAACACATCATTAATCTCATTATTAACAGAATTCAATCCCGTACA
AAAAGCTTGCTTTCCTGTGAATGTAAATACAATTGTTCAAATTTGAAGGA
TATTAATTTGTAGTGGCGTCACATATTCAGAAAGATCATATATAGATAAC
AATTAAGCCACTATGCTGAAAATATAGCCTCCAATACCACAAAAAGTTGT
GCAATTTCCAATTTAACAGGATCTTGAAAGAGAAGCATATGATTTTTGAA
ACATTGCAGCAAGTAATAAGAATATAATGCTCCAATTCAATCCAATATTT
ATACTTCTCTCAAAAAATTGATAGCCAGTCACCCTTTTTCTGTGGCCACC
AAGTGCATGTGCATAAACTTGGACCTAACTGCGGATTCATTA
back to top