CX290866

Overview
NameCX290866
Unique NameCX290866
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length582
Libraries
Library NameType
OF1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX290866_ssr283 microsatellite CX290866_ssr283:283..294.
Properties
Property NameValue
Genbank descriptionC03001A12Rv OF1 Citrus clementina cDNA clone C03001A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX290866 ID=CX290866|Name=CX290866|organism=Citrus clementina|type=EST|length=582bp
CATCAATCATCATCTCTGTTAATGGTTTAAGTTCTTTTACATAGCCAAAA
CCTAGAGTAAAAGAAGATTACGAACCCAATTGGAAGTGTTTGAACTTTAA
GCAAAATAGCCAGCCAGGTAATTTAAGGTAAATGGTTTAAGTTTTGTACT
TTTCGATTTGAATCTTACTTTGTTGCCTTATAAATCAAGAACAAAAAAAG
ATTACAAACACAATTGGATGTCAAGCTTGATTTACTTATCTTTGTTAGTA
TAAATTAATTTCGTAAAAGGAAGTCGGACTTGATTTATTTATTTATCTTT
TCAATTTATTCATGATTTGAATGTTAATTCATAGACAAAACTCAAACCAA
CAACATGCATCAACTTCGATAAAACCAAAAAGGGCTAGGAGGATTAATCT
TGAAAGATTATAAGCTGTAAACACTTGATGCTTTTCTGTTAGTTGAGGTC
GTTTTATAGTAAGCTGATTTGGTTTTGTTGGACCAGACCTTGCTAAGCTC
ATGCATTTAGACATTTATCACTTGCTCTATTACTTTGTTTGTCATATATG
TATCTAGTCTAAAGCTTGGTCAACATGTAGTA
back to top