CX290870

Overview
NameCX290870
Unique NameCX290870
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length394
Libraries
Library NameType
OF1cdna_library
Properties
Property NameValue
Genbank descriptionC03001B04Rv OF1 Citrus clementina cDNA clone C03001B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX290870 ID=CX290870|Name=CX290870|organism=Citrus clementina|type=EST|length=394bp
AGTCAGAATGGAAACAATGTGGTTGAAGAGACTCCTGCTCCTATTGCCCC
TGACCAAGGTCAAGATTGCAGTAGACTACCATCTGGAAGCATTATTAGAA
TCATTGACAGCGATGATGACTGTGCTTCAGAAGAAATTTTGAGCCGAAAT
GGAACCACTTCTCTAAGAGTTGCTAAAAGTTATCATTCAAGTCAGGCTGG
TGCACAACATGTGACAGGAAGGCTCAAAAGAAAGCATGATTCATGTCCAA
TTCTAAATGAAAACAAGAATAGTAATGGTGACAGTGTTGAGGATGAGGCT
GTTGATGATAATTCTTTCACTGCTGATCATAAGCTAGCAAAGATTCAGAA
GTTGAATCACGGACACAATGTTTCCCCTATCAATCATTGTGCAG
back to top