CX290873

Overview
NameCX290873
Unique NameCX290873
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length445
Libraries
Library NameType
OF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC03001B07Rv OF1 Citrus clementina cDNA clone C03001B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX290873 ID=CX290873|Name=CX290873|organism=Citrus clementina|type=EST|length=445bp
ATTATTAAGTTTACCAAATCACAGCCTAGGCTTGTCCTTGATAGATACGG
TGCTGATGAGGGCCATACAGGTATCTGTGGGGTTTCCTTAGGTGATGGTT
CTGTTTGTCAAATGCCACCTGTTGAACAAAGAAAGAGGTGCATTGAACAC
AGAGGTATGAGGATCAGAGCATCAACATTGACAATGAAAGGGAAAGCCAA
AGTGTGTGACGTTGACCCGACGAAGCTACCAATGGTGGCCCAAAAATGCT
CTGTTAGTGAGGGCGAAGAGCGAAACCGGAGAAAAAACTGTGGATCAAAT
TCCAAGTCAACAGGATCATCACAATATGGGCATGATGCGTATGTTGATTC
CAATGCTCCTGGTGCTTTAAATTCCCCCGAAATGTATAGACAGGGAAGGG
TACAATCTAAAGCCAAATTGCAATATGATACCATATGTGGGGTGG
back to top