CX293880

Overview
NameCX293880
Unique NameCX293880
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length403
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig176 contig Ccv1_Contig176:881..1283. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002A05SK FlavRip1 Citrus clementina cDNA clone C05002A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293880 ID=CX293880|Name=CX293880|organism=Citrus clementina|type=EST|length=403bp
AGTACAAAGGAGTAAATAGCAAACAGTAAAAATTCTTTTTGGAGCTCATG
AATTTCTAATCTTTCCAGATGTTCATGGAGTCGCTAGGTGTCATCAATCT
TGTAAATATATTTACTTTTTTCTAAGAGAGCTCCACCTTTTTAGAGTTTC
AGGTCCTTGATTCTTTATTCCCTCCTTAATGTTTATTTGTAGTCGACGTT
GATACTAACAATTTGAAGTTAATATTGGGAAGAAAGGCCAAAAATAGGAC
TGATGTCTTCTTTAAAAATGTCGAATACTAGATCCTTGATATCGTTGAAT
TCAGTTGTTTTCTATTGATCAAATTAATTGGGTTGACTTTAAGTTCTTAG
GAGGGGGCATGCCTTCTACCTTCGGGCTCTGGGACAAAAAAAAAAAAAAA
AAA
back to top