CX293882

Overview
NameCX293882
Unique NameCX293882
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length619
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig521 contig Ccv1_Contig521:1..619. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002A11SK FlavRip1 Citrus clementina cDNA clone C05002A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293882 ID=CX293882|Name=CX293882|organism=Citrus clementina|type=EST|length=619bp
ACGAGGAAACTCACCAGCATTTGCTGTTGGGGGAATTTCAGCCCTTGCTG
GTGGACTCATAGCAATATTAGCTATTCCTCGATCTAGCGCTCAGAAGCCC
AGGGCCCTCCCATGAGCTGATCCTACTTTGGTTACCAAATGTGTGAGTGT
CTAAATGCATCGAATTGCTTGGAAGTTTTTGAAGTTTTGAGGACACTATA
GCCAAATAATAAATTAAACTGGAAACAGTGAGAAAGTTTCTGGGAATCAA
GTCATAGGCTCAAAGGGACTCTATCAACAGTGGCGCTTGTGGACAAAGAG
AAACAAGCAACATATGTGCATAACCATAATAGGAACTTAAATGTAACATT
TAATTATCATTGCCACTCAATACTGCATGAGAGAGCTATCCAAAAGAGTC
CAACATTTCTTTGATGAAATTCATTTTCACTTCTAGAATTGCTGCTTTGT
GACTCCCAAGAGTACTTACTTACCACTCAAGATAAGCCGCTGCCGATTTG
GGATTTATTCCGCATGGAAACATCATATTTTCTGAAGGCAAAGTTGATTG
ACCCTATTGTGGTCCAATTGTGATGTGTTGGATTCTCATACATTTCGCGC
CTGTAATTTGATGCATGAA
back to top