CX293883

Overview
NameCX293883
Unique NameCX293883
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length358
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002A12SK FlavRip1 Citrus clementina cDNA clone C05002A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293883 ID=CX293883|Name=CX293883|organism=Citrus clementina|type=EST|length=358bp
AGGGTGAAAACTGCTAGATTCTGGGGACTTGATGACCAAAGGCCGCGCAA
GATTACTAATGGGGCATTCCAGGGATGAGATGCTAGCACTACTTGCACCA
CCAGCTAGTTGAGTTCTGCAACCTTATGCCTATTATAGTAGTACGCAGGA
ATTTAAGAATGGGAAAGGCTGCCCGAAGGTGGACTGATATAAATTTTAGT
ATCAAATATGCTGATACAACTGGAAACGTTATGCAGTTCCACGCTGAGGT
GAATTAACATTTAGATGTTCCAAATATGCTAACAATGAGAAAAAGACTTT
CCTTCACAATATATTGTCTTTTCTTTCTGAAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
back to top