CX293888

Overview
NameCX293888
Unique NameCX293888
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length516
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX293888_ssr387 microsatellite CX293888_ssr387:387..398. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002B06SK FlavRip1 Citrus clementina cDNA clone C05002B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293888 ID=CX293888|Name=CX293888|organism=Citrus clementina|type=EST|length=516bp
ATTCGGCACGAGGAATAAATGTATTGAGAACAAGCATTGCTTACAACAAC
GTCCCCCAACAAAAAGAGAAAAATGAGTGTGTTGTCAATATTCGATCTGC
GAGAAAAGGTGATTAGGAGAAATGGAGCTGATGCAGCTTGCCCATACTGT
GGAGGGCCTGTGCTGGCAATAGATTTTGATGCCCATTTGAGATTTTGTTT
TCTTCCAATCTCTCATAAAGTTAAGAAGAAATTCTACTGCACAATTTGCT
CCAGACGCTTGGTCCCTGCAACTTCATAAGCAGCAGACGATGATGATGAG
ACATGCATGCTTCATCTTAATTTTGTTTCAATTTTCTCTTTTCCTAATAA
GTCATGTTTGATTGCCTTGCTAAGCAAGGTTGAGTAGTGTGTGTGTGTAA
AACTGTTTCAGAATCTATCTTGTAACAAAACTCAATTACTAAAATAAAAA
GAAATAAGCATTATTGGATTGTTACATATTGCTCTGCTAAAAAAAAAAAA
AAAAAAAACTCGAGGG
back to top