CX293890

Overview
NameCX293890
Unique NameCX293890
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length496
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002B08SK FlavRip1 Citrus clementina cDNA clone C05002B08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293890 ID=CX293890|Name=CX293890|organism=Citrus clementina|type=EST|length=496bp
AGTCCAATCTATTCAACATCCAACATGTCTCAATACTGGCCAGTGCTCAA
GTGTGCATAGTATTTATAAATTGTATGTTTCCTAGTTCTTTTTATTTTTT
TGCCCTGCGTTGAGAAGTCCTCAGTACATTAGCTTACCCCTAATATCCCT
ATGTTTAGTTGGCAGTTAAAGGGAGAAGGAAATAGGGTTCAATCTTTTTG
AGGGATCGGGATTCCTCACTCAATGGTTAAGAATACCAATTCATTCCCCT
CGTACAGTTTAAATTTATTGGTTGGTTAAATCGTTTTTTTCCTTCCCCTT
ACACTTCTAGAATTTATAATTTATTGGTAAAGCCCAAAACAAAATTACAA
AAGATCTGTCGGGTATTTATATCCATGTTCTGGTGATGGATGGTTATAAA
ATGGGAAATGGAAAAGTGAAAGTTGGCTTAAATATTAATTTTATTGACAA
TATGGTGAAGTCATGACCTATTTCTTATTCAATGAGGAATATCAGT
back to top