CX293900

Overview
NameCX293900
Unique NameCX293900
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length366
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig6420 contig Ccv1_Contig6420:586..951. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002C08SK FlavRip1 Citrus clementina cDNA clone C05002C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293900 ID=CX293900|Name=CX293900|organism=Citrus clementina|type=EST|length=366bp
TAATGGACCGAAATCGGAGTATTACAAGAAAAATGCAGTGGAATTGAAGT
ATGCGGCAAGGCAGGCGGTGGCCGGAGGCGGTTCGTCGGACCAGAATATT
CAGTTGTTTGCTGATGAGATTCTTGGAAATTATAGTGAACGTGGGGCACG
TTGTGGAGAAAATTTGGCTTCATCAATGATAGGTTAATATTTATTTTCAA
TATTGCTTGATGTAAAATGAAGTCATAAAAGTAGTACTACAAGAATAAAA
AGGTTGATGGTCCAAATAAACAAGTATTGCTACATAGTTCCATTGGCATT
AATCAATAATTATTTGTAATTGCGAGCCATATTTCAACCAGAATTTGATA
AAAAAAAAAAAAAAAA
back to top