CX293901

Overview
NameCX293901
Unique NameCX293901
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length538
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002C09SK FlavRip1 Citrus clementina cDNA clone C05002C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293901 ID=CX293901|Name=CX293901|organism=Citrus clementina|type=EST|length=538bp
ACTTCACGACAATTTCGATCTAGCGTAAAAATTCAACTACTTACCTCTAA
TCTTTTAGCTGTACCAGTACTGTATTTTTCTTTGATCTCTTGGAATGTCT
TTAGATTTAAATTTGTAAGTGCTTGCGATCGATTCTAAATTGGACGTACA
GTTTTTTTATTCATTACATTGTAATAACATCATAAATTTTGCCTCAATGG
GAGCCACTTGTTCGTATTTCAATATCGAATATGATCGCGAAAAGTACCAT
CCAGGCCAGACGGTCTCCGGTCGAATTGTGTTGCGCATGGATGAGCCAAA
AACAATAAGAGCTGTTGTGCTAACATTGAGCGGCCAGGCGCAGTGTACAT
GGACGACTGAAGAAAGCTCTAGAAATTCAAACTCTAGAAATTTAAACTCT
AGAAATTCAAACTCTAGAAATTCGAATGATCAAATGAAACGAAAAGTATC
TCACTCTGGGAAAGAAACGTTTTTCAATACTAGAATGAACCTAGTCGGCA
GAGGAGAGAAGTTTCTATTACCAATTGGCGAACACATT
back to top