CX293980

Overview
NameCX293980
Unique NameCX293980
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length264
Libraries
Library NameType
FlavRip1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig530 contig Ccv1_Contig530:1..264. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05004D04SK FlavRip1 Citrus clementina cDNA clone C05004D04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293980 ID=CX293980|Name=CX293980|organism=Citrus clementina|type=EST|length=264bp
AATTCGGCACGAGGTTTCATTCTTCTATTAGCTTTTGTGCAATAGCAGTA
GAAGTACTAAATGAATCAGTACTTTCTTGGCATTTTGTTAGCTACCTGTC
AATCTGCCCTATATTTGTAATTAATTCTGTATGCAGTTGCTGTAATTCTA
ATGAAAATCCTATGATTGACGGGATGGTGGTAACGCGTCTTTCTATTTTC
GCTCAAAAAAAAAAAAAAAAAAAACCGCGGGGGGGGGGCCGGGCCCCAAT
TTCCCCTTTTGGGG
back to top