CX293981

Overview
NameCX293981
Unique NameCX293981
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length363
Libraries
Library NameType
FlavRip1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX293981_ssr121 microsatellite CX293981_ssr121:121..132.
CX293981_ssr281 microsatellite CX293981_ssr281:281..292.
Properties
Property NameValue
Genbank descriptionC05004D05SK FlavRip1 Citrus clementina cDNA clone C05004D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293981 ID=CX293981|Name=CX293981|organism=Citrus clementina|type=EST|length=363bp
AGAGATGAAACTAAAGCTTAATCAAGGATTGTTAATCAGTGGAGGTTAAT
TCATGTCATGTGTTAACTTTGCTTGTTTCTCTATATATCTGGGTTTGAGG
GTTTTGATCTTCAAGTACTTTCTCTCTCTCTCTTTTTAATTTGGTTTTCG
TGTTTGAGATTGTTCATTTTCCTTGTCGATTTATAGGGTTAATTCATTGA
CATGAGTGGCTAAGACCTCCTTAATTTGTGATCTCATATTTATGTACAAA
AGAGAGAAGAAGTGTGTTTTGTTCTTGAATATGAATGAATGATTCTCCCT
TTTTCTGAAAAAAAAAAAAAAAAACCCCGGGGGGGGCCCGGGCCCCCATT
TCCCCCTATGGGG
back to top