CX293986

Overview
NameCX293986
Unique NameCX293986
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length436
Libraries
Library NameType
FlavRip1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig3894 contig Ccv1_Contig3894:6..441. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05004D10SK FlavRip1 Citrus clementina cDNA clone C05004D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293986 ID=CX293986|Name=CX293986|organism=Citrus clementina|type=EST|length=436bp
ACCTCTTTTCCTCAGTTTATTTCTTTTGATGCTCTGAGTGAGTCTGTCAC
GAGGGAGGGATAAAAACTAGAGTTTGAGTCAAAAGAAAAGAGTTCCTTCT
CTTTTTCTTCATCATCAATTTCATAGTTTCCCCTTCCAGAGCATCGATCG
TTGAATTCCGGTCTCCGCGATGGCTATAACAATGAAGCAGATGTCTCTTA
TTGTCGGTACTCTCGGTACTTTGTCATTCATATTTGGTGTAGTTGCTGAA
AATAAGAAGCCTGCATCGGGAACTCCGATACCTTTGAAAGGTGGAGTTAT
TTGCGAATATCCATCTGATCCGAGTGTTGTCTTGGGTTACCTGTCTGCTG
CTTTTCTCGTTGCTTCTATTGTGGCCGGCTATCTGTCCTTGTTTTACCCT
TACACAGGAAGATCTGTTCCTCATTCTGTGTTCTTC
back to top