CX293989

Overview
NameCX293989
Unique NameCX293989
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length518
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05004E03SK FlavRip1 Citrus clementina cDNA clone C05004E03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293989 ID=CX293989|Name=CX293989|organism=Citrus clementina|type=EST|length=518bp
GAATCCATTTGATTTCTGAAAAGGATTGCTAACTTTTCGAGGAATCCTTT
ATCATGGTTGTGAATGACTGATTTTTCTCAATTTTTGACCTTGGTTCCAA
GGGAACCAAATTAGAAAGATTGAGAAATAGGACCATCATCAAAATACATG
GCGAAGTTTGAACAAGAGGTCTTTTGTTCTAGGCCCCCACGTTACTTACA
GTTGCATTTGTTTCTACCTTTTGTCTCTGTTTGATCTTGCTCTATCTTTT
TTCTGCCTTTGTTAACTTGATAGCACAGTTAACTTTGTATTTCCACCTAT
ATGAGCTCTAAGAGTTTAGGAGTTTGATATCGATTTTGGATACTCTGATA
TTTTGATGGATGGCATTTTGTGGGTACTTACTTTCTCTTCAAGGTAGGAA
CATTAAATAGACTATTATTAAGCTTAGGTAGCTTAACTTGGGAAAAAGGT
CTGCAAAGGATAGACGTCTTTCATTTTTCTTATTCCTAATTTGGTTATTT
GCCTGCTAATCATAACTG
back to top