CX293992

Overview
NameCX293992
Unique NameCX293992
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length440
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05004E07SK FlavRip1 Citrus clementina cDNA clone C05004E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293992 ID=CX293992|Name=CX293992|organism=Citrus clementina|type=EST|length=440bp
GATTCACTTCTGGATCCAATTTTGTAATAGTTAGGCCCCGCTAACCTCTT
CTTTTAACAATCAAAATTTTATGTACAGTATTTTCTCTTCATATTGTGTA
AGTAATCTTACAATGGAAACTACTGACTTGGAATGCTTTACTGTTATAAG
AACTGTTTGATTCTGAACCTATTGTAAAAACCCAAAAAAAAAAAAAAACC
TCAAACTTAATTTTGGGTTGAAAAGTGAAAACTATCCCTGCTGTTCAAGT
TTGCTTCTATTGGTAGTGGATGAATAATTTGAATATTATCTTGCTGCTGC
TTTGTAATACTAAGCAAATCTCCTGTGTTCAGAACTCATACATGTTCCCC
ATTCAATTCCTTTCTTTTTCTTCTTTCCCCACTTCTTTTTTGGTTTTGGT
TTAATGTACCATGTCACCACTGTTGTGTAGTGATATCGAT
back to top