CX293995

Overview
NameCX293995
Unique NameCX293995
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length532
Libraries
Library NameType
FlavRip1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig530 contig Ccv1_Contig530:32..563. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05004E11SK FlavRip1 Citrus clementina cDNA clone C05004E11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293995 ID=CX293995|Name=CX293995|organism=Citrus clementina|type=EST|length=532bp
CTTTTGTGCAATACCAGTAGAAATACTAAATGAATCAGTACTTTCTTGGC
ATTTTGTTAGCTACCTGTCAATCTGCCCTATATTTGTAATTAATTCTGTA
TGCAGTTGCTGTAATTCTAATGAAAATCCTATGATTGACGGGATGGTGGT
AACGCGTCTTTCTATTTTCGCTCAAAAAAAAAAAAAAAAAAAAACCTGGG
GGGGGGCCCGGGCCCCAAATTACCTACAAATTGGGCCCAGGAAAGGTTAT
TGCTGGCATTGTCAAGAGGTTGGACAAGAGTGCTGAGATGGAGAATATCG
GGGCTTAGAAGTTTAACTAAACACGGCGGCTTCACCATTTCCTGGCAGAG
TTTCTTTGTTCAAGCCAAGCTAAAAGAATTACATTGAAACCATGAACTTT
TTGTGTATTAGAGACCATTTTGAATAGCCTCCTTATTAACTTAAAATTCT
TTGAATCAGGATTAGATTGTAAAAACAGTCTTTCTTTACGCATTATGTAT
GTAACACTACTTGTATTTGGTGCAATAATATA
back to top