CX294327

Overview
NameCX294327
Unique NameCX294327
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length367
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015C03SK FlavSen1 Citrus clementina cDNA clone C05015C03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294327 ID=CX294327; Name=CX294327; organism=Citrus clementina; type=EST; length=367bp
AATTCGGCACGAGGGGAGTATTTCCCAATGGGTGTGCCTGGGTCGGGTTA
TGGACATGGGTACCAGATTCACGGAGGGTATGAATATGGGTACCCTGTTG
GAGGCTACTACCACCAGCCGGCTGCTCCACAAATGTTCAGCGATGAGAAC
CCGAATGCCTGTGTTGTTATGTAGTGAATGATGGTTAGGGAGCAAGCAAA
GGTTATAATGTTATTTACAAGATAGGTTTAATGGGTAACTTCAACCATGG
AAATATTTGTAAATAATAAAGTTCGAGGAGTAAAATTTTGGATTAATCCT
CTTTTATCAAAAAAAAAAAAAAAAAAACCCGGGGGGGGGGCCCGGGCCCC
ATTTCCCCCTTTGGGGG
back to top